version 1.0 import "../../../tasks/skylab/MergeSortBam.wdl" as Merge import "../../../tasks/skylab/FastqProcessing.wdl" as FastqProcessing import "../../../tasks/skylab/PairedTagUtils.wdl" as AddBB import "../../../tasks/broad/Utilities.wdl" as utils import "../../../pipelines/skylab/peak_calling/PeakCalling.wdl" as peakcalling # import peakcalling as subworkflow workflow ATAC { meta { description: "Processing for single-cell ATAC-seq data from the level of raw fastq reads. This is the first step of the multiome pipeline. ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) is a technique used in molecular biology to assess genome-wide chromatin accessibility. This pipeline processes 10x Genomics Multiome ATAC FASTQ files." allowNestedInputs: true } input { # Fastq inputs Array[String] read1_fastq_gzipped Array[String] read2_fastq_gzipped Array[String] read3_fastq_gzipped # Output prefix/base name for all intermediate files and pipeline outputs String input_id String cloud_provider # Additional library aliquot ID String? atac_nhash_id #Expected cells from library preparation Int atac_expected_cells = 3000 # Option for running files with preindex Boolean preindex = false # Option for running peak calling, library level peak calling is always run Boolean peak_calling = false # BWA ref File tar_bwa_reference # BWA machine type -- to select number of splits Int num_threads_bwa = 128 Int mem_size_bwa = 512 String cpu_platform_bwa = "Intel Ice Lake" String vm_size # Text file containing chrom_sizes for genome build (i.e. hg38) File chrom_sizes #File for annotations for calculating ATAC TSSE File annotations_gtf # Whitelist File whitelist # TrimAdapters input String adapter_seq_read1 = "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG" String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG" } String pipeline_version = "2.9.1" # Determine docker prefix based on cloud provider String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/" String acr_docker_prefix = "dsppipelinedev.azurecr.io/" String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix # Docker image names String warp_tools_docker = "warp-tools:2.6.1" String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919" String samtools_docker = "samtools-dist-bwa:3.0.0" String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311" String snap_atac_docker = "snapatac2:2.0.0" # Make sure either 'gcp' or 'azure' is supplied as cloud_provider input. If not, raise an error if ((cloud_provider != "gcp") && (cloud_provider != "azure")) { call utils.ErrorWithMessage as ErrorMessageIncorrectInput { input: message = "cloud_provider must be supplied with either 'gcp' or 'azure'." } } parameter_meta { read1_fastq_gzipped: "read 1 FASTQ file as input for the pipeline, contains read 1 of paired reads" read2_fastq_gzipped: "read 2 FASTQ file as input for the pipeline, contains the cellular barcodes corresponding to the reads in the read1 FASTQ and read 3 FASTQ" read3_fastq_gzipped: "read 3 FASTQ file as input for the pipeline, contains read 2 of paired reads" output_base_name: "base name to be used for the pipelines output and intermediate files" tar_bwa_reference: "the pre built tar file containing the reference fasta and cooresponding reference files for the BWA aligner" num_threads_bwa: "Number of threads for bwa-mem2 task (default: 128)" mem_size_bwa: "Memory size in GB for bwa-mem2 task (default: 512)" cpu_platform_bwa: "CPU platform for bwa-mem2 task (default: Intel Ice Lake)" } call GetNumSplits { input: nthreads = num_threads_bwa, mem_size = mem_size_bwa, cpu_platform = cpu_platform_bwa, vm_size = vm_size } call FastqProcessing.FastqProcessATAC as SplitFastq { input: read1_fastq = read1_fastq_gzipped, read3_fastq = read3_fastq_gzipped, barcodes_fastq = read2_fastq_gzipped, output_base_name = input_id, num_output_files = GetNumSplits.ranks_per_node_out, whitelist = whitelist, docker_path = docker_prefix + warp_tools_docker } scatter(idx in range(length(SplitFastq.fastq_R1_output_array))) { call TrimAdapters { input: read1_fastq = SplitFastq.fastq_R1_output_array[idx], read3_fastq = SplitFastq.fastq_R3_output_array[idx], output_base_name = input_id + "_" + idx, adapter_seq_read1 = adapter_seq_read1, adapter_seq_read3 = adapter_seq_read3, docker_path = docker_prefix + cutadapt_docker } } call BWAPairedEndAlignment { input: read1_fastq = TrimAdapters.fastq_trimmed_adapter_output_read1, read3_fastq = TrimAdapters.fastq_trimmed_adapter_output_read3, tar_bwa_reference = tar_bwa_reference, output_base_name = input_id, nthreads = num_threads_bwa, mem_size = mem_size_bwa, cpu_platform = cpu_platform_bwa, docker_path = docker_prefix + samtools_docker, cloud_provider = cloud_provider, vm_size = vm_size } if (preindex) { call AddBB.AddBBTag as BBTag { input: bam = BWAPairedEndAlignment.bam_aligned_output, input_id = input_id, docker_path = docker_prefix + upstools_docker } call CreateFragmentFile as BB_fragment { input: bam = BBTag.bb_bam, chrom_sizes = chrom_sizes, annotations_gtf = annotations_gtf, preindex = preindex, docker_path = docker_prefix + snap_atac_docker, atac_nhash_id = atac_nhash_id, atac_expected_cells = atac_expected_cells, input_id = input_id } } if (!preindex) { call CreateFragmentFile { input: bam = BWAPairedEndAlignment.bam_aligned_output, chrom_sizes = chrom_sizes, annotations_gtf = annotations_gtf, preindex = preindex, docker_path = docker_prefix + snap_atac_docker, atac_nhash_id = atac_nhash_id, atac_expected_cells = atac_expected_cells, input_id = input_id } if (peak_calling) { call peakcalling.PeakCalling as PeakCalling{ input: output_base_name = input_id, annotations_gtf = annotations_gtf, metrics_h5ad = CreateFragmentFile.Snap_metrics, chrom_sizes = chrom_sizes, cloud_provider = cloud_provider, } } } File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output]) File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file]) File fragment_file_index_atac = select_first([BB_fragment.fragment_file_index, CreateFragmentFile.fragment_file_index]) File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics]) File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics]) output { File bam_aligned_output = bam_aligned_output_atac File fragment_file = fragment_file_atac File fragment_file_index = fragment_file_index_atac File snap_metrics = snap_metrics_atac File library_metrics_file = library_metrics File? cellbybin_h5ad_file = PeakCalling.cellbybin_h5ad File? cellbypeak_h5ad_file = PeakCalling.cellbypeak_h5ad } } # get number of splits task GetNumSplits { input { # machine specs for bwa-mem2 task Int nthreads Int mem_size String cpu_platform String docker_image = "ubuntu@sha256:2e863c44b718727c860746568e1d54afd13b2fa71b160f5cd9058fc436217b30" String vm_size } parameter_meta { docker_image: "the ubuntu docker image (default: ubuntu@sha256:2e863c44b718727c860746568e1d54afd13b2fa71b160f5cd9058fc436217b30)" nthreads: "Number of threads per node (default: 128)" mem_size: "the size of memory used during alignment" vm_size: "the virtual machine used for the task" } command <<< set -euo pipefail echo "Get number of splits for bwa-mem2" echo "#############################################" echo "Machine specs for bwa-mem2 task" echo "#############################################" # steps taken from https://github.com/IntelLabs/Open-Omics-Acceleration-Framework/blob/main/pipelines/fq2sortedbam/print_config.sh num_nodes=1 lscpu lscpu > compute_config num_cpus_per_node=$(cat compute_config | grep -E '^CPU\(s\)' | awk '{print $2}') num_sockets=$(cat compute_config | grep -E '^Socket'| awk '{print $2}') num_numa=$(cat compute_config | grep '^NUMA node(s)' | awk '{print $3}') num_cpus_all_node=`expr ${num_cpus_per_node} \* ${num_nodes}` threads_per_core=$(cat compute_config | grep -E '^Thread' | awk '{print $4}') num_cpus_all_node=`expr ${num_cpus_per_node} \* ${num_nodes}` echo "Number of threads: " $num_cpus_per_node echo "Number of sockets: " $num_sockets echo "Number of NUMA domains: "$num_numa echo "Number of threads per core: "$threads_per_core echo "Number of CPUs: $num_cpus_all_node" num_physical_cores_all_nodes=`expr ${num_cpus_all_node} / ${threads_per_core}` num_physical_cores_per_nodes=`expr ${num_cpus_per_node} / ${threads_per_core}` num_physical_cores_per_socket=`expr ${num_physical_cores_all_nodes} / ${num_sockets}` num_physical_cores_per_numa=`expr ${num_physical_cores_all_nodes} / ${num_numa}` echo "Number physical cores: "$num_physical_cores_per_nodes echo "Number physical cores per socket: "$num_physical_cores_per_socket echo "Number physical cores per numa: "$num_physical_cores_per_numa th=`expr ${num_physical_cores_per_numa} / 2` if [ $th -le 10 ] then th=${num_physical_cores_per_numa} fi while [ $num_physical_cores_per_nodes -gt $th ] do num_physical_cores_per_nodes=`expr $num_physical_cores_per_nodes / 2` done num_physical_cores_per_rank=$num_physical_cores_per_nodes total_num_ranks=`expr ${num_physical_cores_all_nodes} / ${num_physical_cores_per_rank}` ranks_per_node=`expr ${total_num_ranks} / ${num_nodes}` echo "Number of MPI ranks: "${total_num_ranks} echo "Number of cores per MPI rank: "$num_physical_cores_per_nodes echo "#############################################" #echo "Note: Each MPI rank runs a bwa-mem2 process on its input fastq files produced by fqprocess. Please ensure that the number of files created due to bam_size parameter to fqprocess (in config file) creates number of fastq files equal to ${total_num_ranks}" echo "Please set bam_size such that fastqprocess creates ${total_num_ranks} splits of input fastq files" echo "#############################################" echo $total_num_ranks > total_num_ranks.txt echo $ranks_per_node > ranks_per_node.txt >>> runtime { docker: docker_image cpu: nthreads cpuPlatform: cpu_platform memory: "${mem_size} GiB" vm_size: vm_size } output { Int ranks_per_node_out = read_int("ranks_per_node.txt") } } # trim read 1 and read 2 adapter sequeunce with cutadapt task TrimAdapters { input { File read1_fastq File read3_fastq String output_base_name Int min_length = 10 Int quality_cutoff = 0 String adapter_seq_read1 String adapter_seq_read3 # Runtime attributes/docker Int disk_size = ceil(2 * ( size(read1_fastq, "GiB") + size(read3_fastq, "GiB") )) + 200 Int mem_size = 4 String docker_path } parameter_meta { read1_fastq: "read 1 fastq file containing sequencing reads as input for the pipeline" read3_fastq: "read 3 fastq file containing sequencing reads as input for the pipeline" min_length: "the minimum length for trimming. Reads that are too short even before adapter removal are also discarded" quality_cutoff: "cutadapt option to trim low-quality ends from reads before adapter removal" adapter_seq_read1: "cutadapt option for the sequence adapter for read 1 fastq" adapter_seq_read3: "cutadapt option for the sequence adapter for read 3 fastq" output_base_name: "base name to be used for the output of the task" docker_path: "The docker image path containing the runtime environment for this task" mem_size: "the size of memory used during trimming adapters" disk_size : "disk size used in trimming adapters step" } # output names for trimmed reads String fastq_trimmed_adapter_output_name_read1 = output_base_name + ".R1.trimmed_adapters.fastq.gz" String fastq_trimmed_adapter_output_name_read3 = output_base_name + ".R3.trimmed_adapters.fastq.gz" # using cutadapt to trim off sequence adapters command <<< set -euo pipefail # fastq's, "-f", -A for paired adapters read 2" cutadapt \ -Z \ --minimum-length ~{min_length} \ --quality-cutoff ~{quality_cutoff} \ --adapter ~{adapter_seq_read1} \ -A ~{adapter_seq_read3} \ --output ~{fastq_trimmed_adapter_output_name_read1} \ --paired-output ~{fastq_trimmed_adapter_output_name_read3} \ ~{read1_fastq} ~{read3_fastq} >>> # use docker image for given tool cutadapat runtime { docker: docker_path disks: "local-disk ${disk_size} HDD" memory: "${mem_size} GiB" } output { File fastq_trimmed_adapter_output_read1 = fastq_trimmed_adapter_output_name_read1 File fastq_trimmed_adapter_output_read3 = fastq_trimmed_adapter_output_name_read3 } } # align the two trimmed fastq as paired end data using BWA task BWAPairedEndAlignment { input { Array[File] read1_fastq Array[File] read3_fastq File tar_bwa_reference String reference_path = tar_bwa_reference String read_group_id = "RG1" String read_group_sample_name = "RGSN1" String suffix = "trimmed_adapters.fastq.gz" String output_base_name String docker_path String cloud_provider # Runtime attributes Int disk_size = 2000 Int nthreads Int mem_size String cpu_platform String vm_size } parameter_meta { read1_fastq: "the trimmed read 1 fastq file containing sequencing reads as input for the aligner" read3_fastq: "the trimmed read 1 fastq file containing sequencing reads as input for the aligner" tar_bwa_reference: "the pre built tar file containing the reference fasta and cooresponding reference files for the BWA aligner" read_group_id: "the read group id to be added upon alignment" read_group_sample_name: "the read group sample to be added upon alignment" nthreads: "the number of threads to use during bwa alignment" mem_size: "the size of memory used during alignment" disk_size : "disk size used in bwa alignment step" output_base_name: "basename to be used for the output of the task" docker_path: "The docker image path containing the runtime environment for this task" cloud_provider: "The cloud provider for the pipeline." vm_size: "the virtual machine used for the task" } String bam_aligned_output_name = output_base_name + ".bam" # bwa and call samtools to convert sam to bam command <<< set -euo pipefail # print lscpu echo "lscpu output" lscpu echo "end of lscpu output" # prepare reference declare -r REF_DIR=$(mktemp -d genome_referenceXXXXXX) tar -xf "~{tar_bwa_reference}" -C $REF_DIR --strip-components 1 rm "~{tar_bwa_reference}" REF_PAR_DIR=$(basename "$(dirname "$REF_DIR/genome.fa")") echo $REF_PAR_DIR # make read1_fastq and read3_fastq into arrays declare -a R1_ARRAY=(~{sep=' ' read1_fastq}) declare -a R3_ARRAY=(~{sep=' ' read3_fastq}) file_path=`pwd` echo "The current working directory is" $file_path # make input and output directories needed for distributed bwamem2 code mkdir "output_dir" mkdir "input_dir" echo "Move R1, R3 and reference files to input directory." R1="" echo "R1" for fastq in "${R1_ARRAY[@]}"; do mv "$fastq" input_dir; R1+=`basename $fastq`" "; done echo $R1 R3="" echo "R3" for fastq in "${R3_ARRAY[@]}"; do mv "$fastq" input_dir; R3+=`basename $fastq`" "; done echo $R3 mv $REF_DIR input_dir echo "List of files in input directory" ls input_dir # multiome-practice-may15_arcgtf, trimmed_adapters.fastq.gz PREFIX=~{output_base_name} SUFFIX=~{suffix} I1="" R2="" echo "REF_PAR_DIR:" $REF_PAR_DIR REF=$REF_PAR_DIR/genome.fa PARAMS="+R '@RG\tID:~{read_group_id}\tSM:~{read_group_sample_name}' +C" INPUT_DIR=$file_path/input_dir OUTPUT_DIR=$file_path/output_dir input_to_config="INPUT_DIR=\"${INPUT_DIR}\"\nOUTPUT_DIR=\"${OUTPUT_DIR}\"\nPREFIX=\"${PREFIX}\"\nSUFFIX=\"${SUFFIX}\"\n" other_to_add="R1=\"${R1}\"\nR2=\"${R2}\"\nR3=\"${R3}\"\nI1=\"${I1}\"\nREF=\"${REF}\"\n" params="PARAMS=\"${PARAMS}\"" printf "%b" "$input_to_config" printf "%b" "$other_to_add" echo $params # cd into fq2sortedbam cd /usr/temp/Open-Omics-Acceleration-Framework/pipelines/fq2sortedbam # remove the first part of config tail -10 config > config # add inputs to config file (this file is needed to run bwa-mem2 in this specific code" printf "%b" "$input_to_config" | tee -a config printf "%b" "$other_to_add" | tee -a config echo $params | tee -a config echo "CONFIG" cat config # run bwa-mem2 echo "Run distributed BWA-MEM2" ./run_bwa.sh multifq echo "Done running distributed BWA-MEM2" echo "List of files in output directory" ls $OUTPUT_DIR cd $OUTPUT_DIR # remove all files except for final and text file echo "Remove all files except for final bam file and log files" ls | grep -xv final.sorted.bam | grep -v .txt$ | xargs rm echo "List of files in output directory after removal" ls # rename file to this echo "Reheading BAM with reference" /usr/temp/Open-Omics-Acceleration-Framework/applications/samtools/samtools view -H final.sorted.bam > header.txt echo -e "@CO\tReference genome used: ~{reference_path}" >> header.txt /usr/temp/Open-Omics-Acceleration-Framework/applications/samtools/samtools reheader header.txt final.sorted.bam > final.sorted.reheader.bam mv final.sorted.reheader.bam ~{bam_aligned_output_name} echo "the present working dir" pwd # save output logs for bwa-mem2 mkdir output_logs mv *.txt output_logs if [ "~{cloud_provider}" == "gcp" ]; then tar -zcvf output_distbwa_log.tar.gz output_logs mv output_distbwa_log.tar.gz ../ else tar -zcvf output_distbwa_log.tar.gz output_logs mv output_distbwa_log.tar.gz ../ fi # move bam file to the root of cromwell # if the cloud provider is azure, move the file to /cromwell-executions # if the cloud provider is gcp, move the file to /cromwell_root if [ "~{cloud_provider}" == "gcp" ]; then mv ~{bam_aligned_output_name} ../ else mv ~{bam_aligned_output_name} ../ fi >>> runtime { docker: docker_path disks: "local-disk ${disk_size} SSD" cpu: nthreads cpuPlatform: cpu_platform memory: "${mem_size} GiB" vm_size: vm_size } output { File bam_aligned_output = bam_aligned_output_name File output_distbwa_log_tar = "output_distbwa_log.tar.gz" } } # make fragment file task CreateFragmentFile { input { File bam File annotations_gtf File chrom_sizes Boolean preindex Array[String] mito_list = ['chrM', 'M'] Int disk_size = 500 Int mem_size = 64 Int nthreads = 4 String cpuPlatform = "Intel Cascade Lake" String docker_path String atac_nhash_id = "" String input_id Int atac_expected_cells = 3000 String gtf_path = annotations_gtf } parameter_meta { bam: "Aligned bam with CB in CB tag. This is the output of the BWAPairedEndAlignment task." chrom_sizes: "Text file containing chrom_sizes for genome build (i.e. hg38)." annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file." disk_size: "Disk size used in create fragment file step." mem_size: "The size of memory used in create fragment file." docker_path: "The docker image path containing the runtime environment for this task" } command <<< set -euo pipefail set -x python3 < "~{input_id}.fragments.sorted.tsv" echo "Starting bgzip" bgzip "~{input_id}.fragments.sorted.tsv" echo "Starting tabix" tabix -s 1 -b 2 -e 3 -C "~{input_id}.fragments.sorted.tsv.gz" >>> runtime { docker: docker_path disks: "local-disk ${disk_size} SSD" memory: "${mem_size} GiB" cpu: nthreads cpuPlatform: cpuPlatform } output { File fragment_file = "~{input_id}.fragments.sorted.tsv.gz" File fragment_file_index = "~{input_id}.fragments.sorted.tsv.gz.csi" File Snap_metrics = "~{input_id}.metrics.h5ad" File atac_library_metrics = "~{input_id}_~{atac_nhash_id}_library_metrics.csv" } }